Latent human herpesvirus 6 is reactivated in CAR T cells.

Cell therapies have yielded durable clinical benefits for patients with cancer, but the risks associated with the development of therapies from manipulated human cells are understudied. For example, we lack a comprehensive understanding of the mechanisms of toxicities observed in patients receiving T cell therapies, including recent reports of encephalitis caused by reactivation of human herpesvirus 6 (HHV-6)1. Here, through petabase-scale viral genomics mining, we examine the landscape of human latent viral reactivation and demonstrate that HHV-6B can become reactivated in cultures of human CD4+ T cells. Using single-cell sequencing, we identify a rare population of HHV-6 'super-expressors' (about 1 in 300-10,000 cells) that possess high viral transcriptional activity, among research-grade allogeneic chimeric antigen receptor (CAR) T cells. By analysing single-cell sequencing data from patients receiving cell therapy products that are approved by the US Food and Drug Administration2 or are in clinical studies3-5, we identify the presence of HHV-6-super-expressor CAR T cells in patients in vivo. Together, the findings of our study demonstrate the utility of comprehensive genomics analyses in implicating cell therapy products as a potential source contributing to the lytic HHV-6 infection that has been reported in clinical trials1,6-8 and may influence the design and production of autologous and allogeneic cell therapies.

Laboratory assessment of a multi-target assay for the rapid detection of viruses causing vesicular diseases.

BACKGROUND: The recent mpox outbreak has highlighted the need to rapidly diagnose the causative agents of viral vesicular disease to inform treatment and control measures. Common causes of vesicular disease include Monkeypox virus (MPXV), clades I and II, Herpes simplex viruses Type 1 and Type 2 (HSV-1, HSV-2), human herpes virus 6 (HHV-6), Varicella-zoster virus (VZV) and Enteroviruses (EVs). Here, we assessed a syndromic viral vesicular panel for rapid and simultaneous detection of these 7 targets in a single cartridge. OBJECTIVE: The aim of this study was to evaluate the QIAStat-Dx ® viral vesicular (VV) panel and compare with laboratory developed tests (LDTs). Limit of detection, inter-run variability, cross-reactivity and specificity were assessed. Positive and negative percent agreement, and correlation between assays was determined using 124 clinical samples from multiple anatomical sites. RESULTS: The overall concordance between the QIAstat and LDTs was 96%. Positive percent agreement was 82% for HHV-6, 89% for HSV-1 and 100% for MPXV, HSV-2, EV and VZV. Negative percent agreement was 100% for all targets assessed. There was no cross-reactivity with Vaccinia, Orf, Molluscum contagiosum viruses, and a pooled respiratory panel. CONCLUSION: The QIAstat VV multi-target syndromic panel combine ease of use, rapid turnaround, good sensitivity and specificity for enhanced diagnosis, clinical care and public health responses.

Adeno-associated virus type 2 in US children with acute severe hepatitis.

As of August 2022, clusters of acute severe hepatitis of unknown aetiology in children have been reported from 35 countries, including the USA1,2. Previous studies have found human adenoviruses (HAdVs) in the blood from patients in Europe and the USA3-7, although it is unclear whether this virus is causative. Here we used PCR testing, viral enrichment-based sequencing and agnostic metagenomic sequencing to analyse samples from 16 HAdV-positive cases from 1 October 2021 to 22 May 2022, in parallel with 113 controls. In blood from 14 cases, adeno-associated virus type 2 (AAV2) sequences were detected in 93% (13 of 14), compared to 4 (3.5%) of 113 controls (P < 0.001) and to 0 of 30 patients with hepatitis of defined aetiology (P < 0.001). In controls, HAdV type 41 was detected in blood from 9 (39.1%) of the 23 patients with acute gastroenteritis (without hepatitis), including 8 of 9 patients with positive stool HAdV testing, but co-infection with AAV2 was observed in only 3 (13.0%) of these 23 patients versus 93% of cases (P < 0.001). Co-infections by Epstein-Barr virus, human herpesvirus 6 and/or enterovirus A71 were also detected in 12 (85.7%) of 14 cases, with higher herpesvirus detection in cases versus controls (P < 0.001). Our findings suggest that the severity of the disease is related to co-infections involving AAV2 and one or more helper viruses.

The Spontaneous Course of Human Herpesvirus 6 DNA-Associated Myocarditis and the Effect of Immunosuppressive Intervention.

INTRODUCTION: This study investigated the spontaneous clinical course of patients with endomyocardial biopsy (EMB)-proven lymphocytic myocarditis and cardiac human herpesvirus 6 (HHV6) DNA presence, and the effectiveness of steroid-based intervention in HHV6-positive patients. RESULTS: 756 heart failure (HF) patients underwent an EMB procedure to determine the underlying cause of unexplained HF. Low levels of HHV6 DNA, detectable by nested PCR only, were found in 10.4% of the cases (n = 79) of which 62% (n = 49) showed myocardial inflammation. The spontaneous course of patients with EMB-proven HHV6 DNA-associated lymphocytic myocarditis (n = 26) showed significant improvements in the left ventricular ejection fraction (LVEF) and clinical symptoms, respectively, in 15/26 (60%) patients, 3-12 months after disease onset. EMB mRNA expression of components of the NLRP3 inflammasome pathway and protein analysis of cardiac remodeling markers, analyzed by real-time PCR and MALDI mass spectrometry, respectively, did not differ between HHV6-positive and -negative patients. In another cohort of patients with ongoing symptoms related to lymphocytic myocarditis associated with cardiac levels of HHV6-DNA copy numbers <500 copies/µg cardiac DNA, quantified by real-time PCR, the efficacy and safety of steroid-based immunosuppression for six months was investigated. Steroid-based immunosuppression improved the LVEF (≥5%) in 8/10 patients and reduced cardiac inflammation in 7/10 patients, without an increase in cardiac HHV6 DNA levels in follow-up EMBs. CONCLUSION: Low HHV6 DNA levels are frequently detected in the myocardium, independent of inflammation. In patients with lymphocytic myocarditis with low levels of HHV6 DNA, the spontaneous clinical improvement is nearby 60%. In selected symptomatic patients with cardiac HHV6 DNA copy numbers less than 500 copies/µg cardiac DNA and without signs of an active systemic HHV6 infection, steroid-based therapy was found to be effective and safe. This finding needs to be further confirmed in large, randomized trials.

Roseola Infantum During the COVID-19 Pandemic.

INTRODUCTION: Roseola infantum is always considered to be among the differential diagnosis of young patients with fever and leukopenia whom to be strictly isolated with the preliminary diagnosis of COVID-19 until otherwise proven during the pandemic. RESULTS: Human herpes virus-6 (HHV-6) polymerase chain reaction (PCR) blood test was performed in 4 of 7 patients with a clinical diagnosis of roseola infantum and all found to be HHV-6 PCR positive. The most striking laboratory finding in all patients was leukopenia. HHV-6 PCR tests were found to be positive. Severe acute respiratory syndrome coronavirus-2 testing were found to be negative in all patients. CONCLUSION: During the peak of the pandemic, children continued to present with fever because of viral infections other than COVID-19.

iciHHV-6 in a Patient With Multisystem Inflammatory Syndrome in Children.

Multisystem inflammatory syndrome in children (MIS-C) is a serious, sometimes life-threatening late complication of coronavirus disease 2019 (COVID-19) with multiorgan involvement and evidence of immune activation. The pathogenesis of MIS-C is not known, nor is the pathogenesis of the severe organ damage that is the hallmark of MIS-C. Human herpesvirus 6 (HHV-6), the virus responsible for roseola, is a ubiquitous herpesvirus that causes close to universal infection by the age of 3 years. HHV-6 remains latent for life and can be activated during inflammatory states, by other viruses, and by host cell apoptosis. HHV-6 has been associated with end-organ diseases, including hepatitis, carditis, and encephalitis. In addition, ∼1% of people have inherited chromosomally integrated human herpesvirus 6 (iciHHV-6), which is HHV-6 that has been integrated into chromosomal telomeric regions and is transmitted through the germ line. iciHHV-6 can be reactivated and has been associated with altered immune responses. We report here a case of MIS-C in which an initial high HHV-6 DNA polymerase chain reaction viral load assay prompted testing for iciHHV-6, which yielded a positive result. Additional research may be warranted to determine if iciHHV-6 is commonly observed in patients with MIS-C and, if so, whether it may play a part in MIS-C pathogenesis.

Reduced impact of viral load of HHV-6 in liquor on severity of AESD due to exanthema subitum: A case report and literature review.

BACKGROUND: The most common causative pathogen of acute encephalopathy with biphasic seizures and late reduced diffusion (AESD) was reported as HHV-6. Although excitotoxic injury with delayed neuronal death is considered to be a possible pathogenesis of AESD, the detailed pathophysiology remains unclear. CASE PRESENTATION: We present a twelve-month-old girl with AESD due to HHV-6 primary infection. She was successfully treated for AESD including targeted temperature management and the administration of vitamin B1, B6, and L-carnitine. Although the viral load of HHV-6 in her liquor was high (12,000 copies/mL), she fully recovered without antiviral agent use. DISCUSSION: There has been no study focusing on the HHV-6 viral load in patients with AESD, and only a few case reports have been published. We reviewed the clinical features and viral load in the liquor of our case and four reported infants with AESD due to HHV-6 primary infection who had real-time PCR tests results. Viral loads in the three patients with a poor prognosis were 31.5, negative, and 3,390 copies/mL, respectively. On the other hand, the copy numbers of HHV-6 DNA in the two patients with no sequelae were 12,000 and 106 copies/mL, respectively, and our case had the highest viral load among the five summarized patients.

Severe herpes virus 6 interstitial pneumonia in an infant with three variants in genes predisposing to lung disease.

Infections due to human herpesvirus 6 (HHV-6) are frequent during early childhood. Usually, they have a favorable clinical course. Conversely, HHV-6 congenital infections occur in about 1% of neonates and may present with more severe clinical pictures. HHV-6 can be found in lung tissues and bronchoalveolar lavage (BAL) samples from patients with pneumonia and in immunocompromised patients can cause mild to severe pneumonia. In neonates, the role of HHV-6 in the genesis of severe pneumonia is poorly defined still now. We describe a healthy infant with a late-onset (15 days of life) severe interstitial pneumonia and heavy HHV-6 genome load, persistently detected in its BAL fluid. The baby underwent high-frequency oscillatory ventilation, hydroxychloroquine, steroids, and ganciclovir for 6 weeks and at 9 months she died. Next-generation sequencing of genes known to cause neonatal respiratory insufficiency revealed the presence of a "probably pathogenetic" heterozygous variant in the autosomal recessive DRC1 gene, a heterozygous variant of unknown significance (VUS) in the autosomal recessive RSPH9 gene, and a heterozygous VUS in the autosomal recessive MUC5B gene. HHV-6 infection should be considered in the differential diagnosis of late-onset severe respiratory distress in neonates and the co-occurrence of genetic predisposing factors or modifiers should be tested by specific molecular techniques. The intensity of HHV-6 genome load in BAL fluid could be an indicator of the response to antiviral therapy.

The role of early natural killer cell adoptive infusion before engraftment in protecting against human herpesvirus-6B encephalitis after naïve T-cell-depleted allogeneic stem cell transplantation.

BACKGROUND: Naïve T-cell-depleted grafts have been employed as an ex vivo T-cell depletion (TCD) platform to prevent graft-versus-host disease (GvHD) and improve immune reconstitution by providing rapid donor memory T-cell reconstitution after allogenic hematopoietic stem cell transplantation (allo-HSCT). CD45RA- memory T cells confer protection against viruses such as cytomegalovirus, Epstein-Barr virus, and adenovirus; however, reports have shown an unexpectedly high incidence of human herpesvirus (HHV)-6B encephalitis among pediatric allo-HSCT patients. METHODS: We report the first 18 consecutive allo-HSCT, 16 haplo-HSCT, and two human leukocyte antigen-matched related donors implanted with naïve TCD grafts. All donors were administered three cell products: first, a CD34+ stem cell product; second, a CD45RA+ TCD graft, followed by an adoptive natural killer (NK) cell infusion within 10 days after HSCT. The study's primary endpoint was the incidence of HHV-6B encephalitis. RESULTS: Engraftment was achieved in 94.5% of cases; 2-year overall survival, event-free survival, and GvHD/relapse-free survival were 87.2% (95% CI 78.6-95.8), 67.3% (95% CI 53.1-81.5), and 64% (95% CI 50.5-78.1), respectively. HHV-6B reactivation occurred in 7 of the haplo-HSCT patients, six of who received a cell infusion with an NK/CD4 ratio <2. None of the patients developed encephalitis. CONCLUSIONS: In this clinical study, we show that early adoptive NK cell infusion after a 45RA+ TCD allo-HSCT graft is safe and can prevent HHV-6B encephalitis. We recommend infusing adoptive NK cells after allo-HSCT using CD45RA+ TCD grafts.

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

Donor-Derived CD4+ T Cells and Human Herpesvirus 6B Detection After Allogeneic Hematopoietic Cell Transplantation.

We sought to determine whether donor-derived human herpesvirus (HHV) 6B-specific CD4+ T-cell abundance is correlated with HHV-6B detection after allogeneic hematopoietic cell transplantation. We identified 33 patients who received HLA-matched, non-T-cell-depleted, myeloablative allogeneic hematopoietic cell transplantation and underwent weekly plasma polymerase chain reaction testing for HHV-6B for 100 days thereafter. We tested donor peripheral blood mononuclear cells for HHV-6B-specific CD4+ T cells. Patients with HHV-6B detection above the median peak viral load (200 copies/mL) received approximately 10-fold fewer donor-derived total or HHV-6B-specific CD4+ T cells than those with peak HHV-6B detection at ≤200 copies/mL or with no HHV-6B detection. These data suggest the importance of donor-derived immunity for controlling HHV-6B reactivation.

MicroRNAs of Human Herpesvirus 6A and 6B in Serum and Cerebrospinal Fluid of Multiple Sclerosis Patients.

Human herpesvirus-6A (HHV-6A) and -6B (HHV-6B) might be involved in the etiopathogenesis of multiple sclerosis (MS), especially the HHV-6A. We aim at assessing, for the first time in the scientific literature, the HHV-6A/B microRNAs in MS patients. We analyzed the miRNAs of HHV-6A: miR-U86, and -6B: hhv6b-miR-Ro6-1, -2, -3-3p, -3-5p, and -4 in paired samples of serum and CSF of 42 untreated MS patients and 23 patients with other neurological diseases (OND), using Taqman MicroRNA Assays. Intrathecal HHV-6A/B antibody production and anti-HHV-6A/B IgG/IgM levels in serum were measured. MS clinical data were available. We detected the following miRNAs: hhv6b-miR-Ro6-2 (serum: MS:97.7%, OND:95.7%; CSF: MS:81%, OND:86.4%), 3-3p (serum: MS:4.8%, OND:0%; CSF: MS:2.4%, OND:4.5%), -3-5p (serum: MS:95.2%, OND:91.3%; CSF: MS:50%, OND:54.5%), and miR-U86 (serum: MS:54.8%, OND:47.8%; CSF: MS:11.9%, OND:9.1%). In the serum of the whole population (MS and OND patients) we found a significant correlation between the levels of hhv6b-miR-Ro6-2 and -3-5p (Spearman r = 0.839, pcorr = 3E-13), -2 and miR-U86 (Spearman r = 0.578, pcorr = 0.001) and -3-5p and miR-U86 (Spearman r = 0.698, pcorr = 1.34E-5); also in the CSF, between hhv6b-miR-Ro6-2 and -3-5p (Spearman r = 0.626, pcorr = 8.52E-4). These correlations remained statistically significant when both populations were considered separately. The anti-HHV-6A/B IgG levels in CSF and the intrathecal antibody production in positive MS patients for hhv6b-miR-Ro6-3-5p were statistically significant higher than in the negative ones (pcorr = 0.006 and pcorr = 0.036). The prevalence of miR-U86 (30.8%) in the CSF of individuals without gadolinium-enhancing lesions was higher (p = 0.035) than in the ones with these lesions (0%); however, the difference did not withstand Bonferroni correction (pcorr = 0.105). We propose a role of HHV-6A/B miRNAs in the maintenance of the viral latency state. Further investigations are warranted to validate these results and clarify the function of these viral miRNAs.

Search for viral agents in cerebrospinal fluid in patients with multiple sclerosis using real-time PCR and metagenomics.

Multiple sclerosis (MS) is a chronic, immune-mediated demyelinating disease of the central nervous system of unclear etiology, but there is some evidence that viral infections could be responsible for triggering autoimmune mechanisms against myelin. We searched for viral RNA and DNA in cerebrospinal fluid (CSF) of 34 MS patients and 13 controls using RT-PCR/PCR against common neurotropic viruses. In addition, shotgun DNA- and RNA-based metagenomics were done in 13 MS patients and 4 controls. Specific quantitative real-time RT-PCR/PCR testing revealed the presence of viral nucleic acid in seven (20.59%) MS patients and in one (7.69%) control patient. In MS patients the most frequently detected was human herpesvirus type 6 (HHV-6; 3 cases; 8.82%); followed by Epstein-Barr virus (EBV; 2 cases; 5.88%), varicella zoster virus (VZV; 1 case; 2.94%) and Enterovirus (EV; 1 case; 2.94%). The single identified virus among controls was EBV (7.69%). DNA and RNA metagenomic assays did not identify any known eukaryotic viruses even though three of the analyzed samples were low-level positive by specific quantitative real-time PCR. In conclusion, we detected the presence of Herpesviridae and occasionally Enteroviridae in CSF from patients with MS but their prevalence was not significantly higher than among controls. Metagenomic analysis seems to be less sensitive than real-time RT-PCR/PCR and it did not detect any potential viral pathogens.

Impact of Human Cytomegalovirus and Human Herpesvirus 6 Infection on the Expression of Factors Associated with Cell Fibrosis and Apoptosis: Clues for Implication in Systemic Sclerosis Development.

Systemic sclerosis (SSc) is a severe autoimmune disorder characterized by vasculopathy and multi-organ fibrosis; its etiology and pathogenesis are still largely unknown. Herpesvirus infections, particularly by human cytomegalovirus (HCMV) and human herpesvirus 6 (HHV-6), have been suggested among triggers of the disease based on virological and immunological observations. However, the direct impact of HCMV and/or HHV-6 infection on cell fibrosis and apoptosis at the cell microenvironment level has not yet been clarified. Thus, this study aimed to investigate the effects of HCMV and HHV-6 infection on the induction of pro-fibrosis or pro-apoptosis conditions in primary human dermal fibroblasts, one of the relevant SSc target cells. The analysis, performed by microarray in in vitro HCMV- or HHV-6-infected vs. uninfected cells, using specific panels for the detection of the main cellular factors associated with fibrosis or apoptosis, showed that both viruses significantly modified the expression of at least 30 pro-fibrotic and 20 pro-apoptotic factors. Notably, several recognized pro-fibrotic factors were highly induced, and most of them were reported to be involved in vivo in the multifactorial and multistep pathogenic process of SSc, thus suggesting a potential role of both HCMV and HHV-6.

Human Herpes Virus 6 Detection in Children With Suspected Central Nervous System Infection.

Human herpes virus 6 (HHV-6) infection is considered a self-limited disease in immunocompetent children. However, HHV-6 could be associated with various neurologic diseases. We describe 8 children with suspected central nervous system infection and detection of HHV-6 in cerebrospinal fluid. The clinical significance of HHV-6 detection is controversial because it may be caused by primary infection, reactivation or latency.

Animal Models of Alzheimer's Disease Should Be Controlled for Roseolovirus.

Animal models to study Alzheimer's disease (AD) pathogenesis are under development. Since herpesviruses have been postulated to be capable of triggering the pathogenic process, AD animal models (mouse, pig, and non-human primates) should be controlled for the presence of these viruses. Only virus-free models allow studying the genetic factors and the effect of adding viruses. Roseoloviruses such as human herpesvirus 6 and the related viruses in the animals are the main topic of this commentary.